Disclaimer

This site is provided for educational purposes only. The providers of this site make no warranty that any species identification made using this site is correct and reliable. 

The species identification provided are the top matches of each actual DNA sequence we obtained to a published DNA sequence made from an extract of that particular organism's DNA. However, these are not necessarily always the true species, genera, or families. Use your imagination when interpreting this list. If you see a species that looks suspect, think about what it could be.

Examples of Suspect Results

1. Related genus or family

For example, we obtained a top match of a sequence to "Paludinella minima". That sequence was:

ATTGGCCGGTAATTTAGCTCATGCTGGTGGGTCAGTTGATTTAGCTATTTTCTCATTACATTTGGCAGGTGTATCGTCTATTTTAGGTGCAGTAAATTTTATTACGACAATTATTAATATGCGTTGACGTGGAATACAATTCGAGCGATTACCTTTATTTGTTTGGTCAGTTAAAATTACTGCAGTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATGCT.

Does that mean we have the first record of this Japanese endemic snail and that we should report it to Science? Not at all! It means we might have a related species here, possibly one in the same genus or family that has not been sequenced yet. This result is still useful because it gives our buddies in snail research a clue of where to search for species that need to be sequenced, so they too can be in the published reference database. Who knows – maybe the species they collect from that eDNA tip will be new to science!

2. Related subspecies

We also encourage you to be skeptical of species with domesticated relatives. In the eDNA data, many sequences match to wolf, but there are no wolves left in California. However, dogs were domesticated from wolves and their Latin names indicate they are a subspecies of wolf. Therefore, a wolf sequence can be interpreted as someone's pet. 

3. Sequence that match multiple species

We sometimes have sequences that match multiple species equally well. In this case, we use statistical programs to choose the right level of taxonomy to report. If the multiple matches all share the same genus, we will likely only report the genus level and not the species level. If multiple genera have equally good matches to the DNA sequence but are all in the same family, we will report only down to the family level. 

In rare cases we might have sequences with errors, or sequences that are too short to correctly assign. For instance, you might see two unique sequences that identify as different pine tree species in the same sample: one is the pine that is common in California, while the other is from some far away land. Although we will initially report both species, we will later relabel the sequences for the unusual pine to the genus level, Pinus, as the species match is likely erroneous.

Reasons for Mismatches

These mismatches occur because we currently have a size-able but still largely incomplete fraction of California's native, naturalized, and invasive species with sequenced DNA. Many initiatives like the Diversity Initiative for the Southern California Ocean (DISCO, run through the Natural History Museum Los Angeles) are working hard to sequence the DNA barcoding regions that we use, for different species so we can eventually have a complete reference database. Other countries have their own sequencing initiatives too, which is why we sometimes find a DNA sequence in soil or sediment that has a best match to an organism that lives far away from California. 

For More Information

Always feel free to get in contact with us if you have questions about the meaning of eDNA results. At the University of California, we have dozens of people going through these results to make sense of them, so we are all exploring these at the same time! Your ideas, interpretation, and questions are extremely helpful to us. Thank you for exploring CALeDNA data!